Those trustworthy “health experts and fact checkers” have been informing us for over a year that mRNA vaccines, such as those made by Pfizer and Moderna, do not incorporate into human cellular DNA.
However, a recent study published in Current Issues in Molecular Biology revealed that health experts and fact checkers were inaccurate.
Now, the question to be asked: Were they lying or were they mistaken? Tough question, yes? Those of us who possess even the slightest degree of cynicism know not to trust the fact checkers or the health experts.
Suggestion: Before getting caught up in the complications of this article, Read Simplified Below at the bottom first.
This from en-volve.com.
So, we now know that mRNA vaccinations DO incorporate themselves into human cellular DNA, according to lab experiments.
These vaccines, in essence, alter your DNA for the rest of your life.

What that signifies is that lab experiments have shown that mRNA vaccines DO integrate into human cellular DNA. This means that even a single dose of Pfizer vaccine permanently alters the DNA of afflicted cells.

However, the bombshell article from Current Issues of Molecular Biology suggests they have been spreading disinformation all along.
A new study is out: Intracellular Reverse Transcription of Pfizer BioNTech COVID-19 mRNA Vaccine BNT162b2 In Vitro in Human Liver Cell Line.

IgorChudov reports:
What it is saying is: lab studies show that mRNA vaccine DOES integrate itself into human cellular DNA. This means that a shot of Pfizer vaccine, taken even once, permanently changes the DNA of affected cells.
However, the bombshell article from Current Issues of Molecular Biology shows the opposite.

What the article shows is that in vitro, using a human liver cell line, Pfizer mRNA vaccine uses a natural reverse transcriptase enzyme called LINE-1, and the genetic code of the vaccine is reverse transcribed into the DNA.
It also explains that vaccine mRNA actually does travel to the liver as one of the preferred sites (the other sites, as we heard, are ovaries and more).
What does it mean? Normally, our cells do the opposite: the cell nucleus, where the DNA is, expresses certain DNA code based on conditions of the cell, and produces natural, human messenger RNA. That messenger RNA travels out of the nucleus, where it is expressed into proteins needed for cell building. This is how growing organisms express different genetic programs to grow muscle cells or brain cells, etc.
This process is called “transcription”.
For many years, Central Dogma of Molecular Biology stated that the “reverse transcription” — moving genetic code from RNA back into the sacred cellular nucleus and recoding the DNA — was impossible. Eventually, scientists realized that it is possible under various conditions. For example, the HIV RNA virus is able to do so and it reprograms our DNA to produce copies of it. HIV is the virus that causes AIDS.
To effect reverse transcription, enzymes called “reverse transcriptases” are needed. One of them is called LINE-1.
Apparently, per study, the Pfizer mRNA vaccine causes cells to produce that LINE-1 enzyme.

After seeing LINE-1 reverse transcriptase rise, they tested for alterations to the DNA, making sure they are not picking up the RNA instead.

The genetic code that they picked up is:
CGAGGTGGCCAAGAATCTGAACGAGA
GCCTGATCGACCTGCAAGAACTGGGGAAGT ACGAGCAGTACATCAAGTGGCCCTGGTACA
TCTGGCTGGGCTTTATCGCCGGACTGATTG CCATCGTGATGGTCACAATCATGCTGTGTT
GCATGACCAGCTGCTGTAGCTGCCTGAAGG GCTGTTGTAGCTGTGGCAGCTGCTGCAAGT
TCGACGAGGACGATTCTGAGCCCGTGCTGA
AGGGCGTGAAACTGCACTACACATGATGAC
TCGAGCTGGTACTGCATGCACGCAATGCTA GCTGCCCCTTTCCCGTCCTGGGTACCCCGA
GTCTCCCCCGACCTCGGGTCCCAGGTATGC TCCCACCTCCACCTGCCCCACTCACCACCT
CTGCTAGTTCCAGACACCTCCCAAGCACGC AGCAATGCAGCTCAAAACGCTTAGCCTA
Anyone wants to run BLAST on it?
Simplified Below:
As explained in response to a questioner:
Pfizer mRNA vaccine changes our genetic code that determines how our organisms operate, that you inherited from your mom and dad. Now your DNA was changed from what your mom and dad gave you, by adding a little mysterious “edit” from Pfizer.
Your organism acts in accordance with your DNA program, and now, well, the program has been hacked and modified by Pfizer.
Considering that Sars-Cov-2 “spike protein” has cancer code from Moderna 2017’ patent 9,587,003, it is imperative to find out the implications of this reverse transcription, and whether the vaccinated now have any undesirable genetic code embedded into their DNA.
Of particular interest is whether this mRNA-induced reverse transcription affects the “germ line”, such as eggs and sperm cells, and whether it also affects the fetus of pregnant mothers.
Please repost this article far and wide due to its big implication for our public health.
EDIT: Our astute commenter pointed out an anonymous 4chan post from Dec 2020, long before any of this became known. The date makes us all ask, did this person know too much?

Does “…next generation female offspring have premature ovarian failure” mean what I think it means?
With the above information now known, why aren’t those responsible for this evil scheme being rounded up and charged for Crimes Against Humanity?
Answer: democrat-communists.